Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 2741986
End position: 2742009
Length: 24

DNA sequence
>NC_021171, from 2741986 to 2742009 (24 bp); Bacillus sp. 1NLA3E TACCCATAACCATATCCATAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2741974-2742294	Sequence	B1NLA3E_12430 - hypothetical protein (Protein is coded in complementary strand; from 2742294 to 2741974)