Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 2189080
End position: 2189115
Length: 36

DNA sequence
>NC_021171, from 2189080 to 2189115 (36 bp); Bacillus sp. 1NLA3E CGTTCAAGCCGCCGTTCAAGCCGCCGTTCAAGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2189076-2189579	Sequence	B1NLA3E_09995 - hypothetical protein (Protein is coded in complementary strand; from 2189579 to 2189076)