Sequence retrieval

Genome: Bacillus sp. 1NLA3E
Start position: 1977461
End position: 1977484
Length: 24

DNA sequence
>NC_021171, from 1977461 to 1977484 (24 bp); Bacillus sp. 1NLA3E TTCTTTTACTTTCTCTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1977467-1977688	Sequence	B1NLA3E_09015 - hypothetical protein (Protein is coded in complementary strand; from 1977688 to 1977467)