Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 3244293
End position: 3244337
Length: 45

DNA sequence
>NC_021151, from 3244293 to 3244337 (45 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 TGCGATGTCTGCGATGTCTGCGATGTCTGCGATGTCTGCGATGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3244298-3244411	Sequence	STU288_15605 - putative racemase