Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 2713408
End position: 2713467
Length: 60

DNA sequence
>NC_021151, from 2713408 to 2713467 (60 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 CCGACCTGCGCGATGCCGACCTGTGCGGTGCCGACCTGCGCGATGCCGACCTGCCTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2713144-2713548	Sequence	STU288_13010 - hypothetical protein (Protein is coded in complementary strand; from 2713548 to 2713144)