Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 1785669
End position: 1785698
Length: 30

DNA sequence
>NC_021151, from 1785669 to 1785698 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1784811-1785998	Sequence	STU288_08675 - ethanol dehydrogenase EutG (Protein is coded in complementary strand; from 1785998 to 1784811)