Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. U288
Start position: 1267949
End position: 1267984
Length: 36

DNA sequence
>NC_021151, from 1267949 to 1267984 (36 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. U288 TACGGCAGCGGCGTCGGCAGCGGCGTCGGCAGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1267949-1268374	Sequence	STU288_06210 - lipoprotein (Protein is coded in complementary strand; from 1268374 to 1267949)