Sequence retrieval

Genome: Propionibacterium acnes HL096PA1
Start position: 1986284
End position: 1986319
Length: 36

DNA sequence
>NC_021085, from 1986284 to 1986319 (36 bp); Propionibacterium acnes HL096PA1 GTCGGAGTCGGCGTGGGAGTAGGAGTCGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1986107-1987033	Sequence	PAGK_1798 - putative adhesion or S-layer protein (Protein is coded in complementary strand; from 1987033 to 1986107)