Sequence retrieval

Genome: Propionibacterium acnes HL096PA1
Start position: 1454041
End position: 1454064
Length: 24

DNA sequence
>NC_021085, from 1454041 to 1454064 (24 bp); Propionibacterium acnes HL096PA1 ACGACGACGACGGCGACGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1452479-1455103	Sequence	PAGK_1308 - putative ribonuclease (Protein is coded in complementary strand; from 1455103 to 1452479)