Sequence retrieval

Genome: Chlamydia trachomatis E Bour
Start position: 1036026
End position: 1036049
Length: 24

DNA sequence
>NC_020971, from 1036026 to 1036049 (24 bp); Chlamydia trachomatis E Bour CTCCAGCACCAGCACCAGCTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1035552-1038602	Sequence	BOUR_00937 - chlamydial polymorphic outer membrane protein repeat