Sequence retrieval

Genome: Chlamydia trachomatis G SotonG1
Start position: 651128
End position: 651163
Length: 36

DNA sequence
>NC_020941, from 651128 to 651163 (36 bp); Chlamydia trachomatis G SotonG1 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650127-651590	Sequence	SOTONG1_00612 - Secretion system effector C (SseC) like family protein