Sequence retrieval

Genome: Chlamydia trachomatis G SotonG1
Start position: 334700
End position: 334723
Length: 24

DNA sequence
>NC_020941, from 334700 to 334723 (24 bp); Chlamydia trachomatis G SotonG1 TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 334720-337524	Sequence	SOTONG1_00310 - serine/threonine-protein kinase (Protein is coded in complementary strand; from 337524 to 334720)