Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 2206919
End position: 2206972
Length: 54

DNA sequence
>NC_020802, from 2206919 to 2206972 (54 bp); Psychromonas sp. CNPT3 CCACGCGTTTAACTTCTGCTACGCGTTTAACTTCTGCTACGCGTTTAACTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2206429-2207400	Sequence	PCNPT3_09365 - TolA family protein (Protein is coded in complementary strand; from 2207400 to 2206429)