Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 2486991
End position: 2487035
Length: 45

DNA sequence
>NC_020802, from 2486991 to 2487035 (45 bp); Psychromonas sp. CNPT3 AACTAGCTCATTAGCAACTAGCTCATTAGTAACTGGCTCATTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2485888-2487393	Sequence	PCNPT3_10575 - flagellar hook-length control protein (Protein is coded in complementary strand; from 2487393 to 2485888)