Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 1594594
End position: 1594635
Length: 42

DNA sequence
>NC_020802, from 1594594 to 1594635 (42 bp); Psychromonas sp. CNPT3 ACATTTATTATTTAACATTTATTATTTAACATTTACTATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1594630-1597065	Sequence	PCNPT3_06785 - polyunsaturated fatty acid synthase PfaB (Protein is coded in complementary strand; from 1597065 to 1594630)