Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 1992429
End position: 1992458
Length: 30

DNA sequence
>NC_020802, from 1992429 to 1992458 (30 bp); Psychromonas sp. CNPT3 ATCGGTATCTGTATCGCTATCTGTATCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1991281-1993992	Sequence	PCNPT3_08420 - ClpV protein (Protein is coded in complementary strand; from 1993992 to 1991281)