Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 1180603
End position: 1180632
Length: 30

DNA sequence
>NC_020802, from 1180603 to 1180632 (30 bp); Psychromonas sp. CNPT3 TTTTAATTAATATTAATTAAGGTTAATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1180630-1181922	Sequence	PCNPT3_05015 - citrate synthase I (Protein is coded in complementary strand; from 1181922 to 1180630)