Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 677983
End position: 678010
Length: 28

DNA sequence
>NC_020802, from 677983 to 678010 (28 bp); Psychromonas sp. CNPT3 TTTTTGTTTTTCGTCTTTTGTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 677821-678213	Sequence	PCNPT3_02860 - hypothetical protein (Protein is coded in complementary strand; from 678213 to 677821)