Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 2457165
End position: 2457191
Length: 27

DNA sequence
>NC_020802, from 2457165 to 2457191 (27 bp); Psychromonas sp. CNPT3 CAACATCAACAACATCACCAACAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2455706-2457376	Sequence	PCNPT3_10405 rpsA 30S ribosomal protein S1 (Protein is coded in complementary strand; from 2457376 to 2455706)