Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 1997248
End position: 1997274
Length: 27

DNA sequence
>NC_020802, from 1997248 to 1997274 (27 bp); Psychromonas sp. CNPT3 TATCATCTATCTCATCTATGTCATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1996611-1998119	Sequence	PCNPT3_08440 - type VI secretion system protein ImpI (Protein is coded in complementary strand; from 1998119 to 1996611)