Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 366312
End position: 366336
Length: 25

DNA sequence
>NC_020802, from 366312 to 366336 (25 bp); Psychromonas sp. CNPT3 TTTTTTTTTCTGTTTTTATTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 366272-366700	Sequence	PCNPT3_01560 - hypothetical protein (Protein is coded in complementary strand; from 366700 to 366272)