Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 843159
End position: 843182
Length: 24

DNA sequence
>NC_020802, from 843159 to 843182 (24 bp); Psychromonas sp. CNPT3 TGTTGGTGTCGGTGGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 843074-844279	Sequence	PCNPT3_03520 - cell division GTP-binding tubulin-like protein FtsZ