Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 3007536
End position: 3007559
Length: 24

DNA sequence
>NC_020802, from 3007536 to 3007559 (24 bp); Psychromonas sp. CNPT3 AAATTCAAATTGTAATTCAAATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3005467-3007686	Sequence	PCNPT3_12710 - type IV pilus secretin PilQ (Protein is coded in complementary strand; from 3007686 to 3005467)