Sequence retrieval

Genome: Psychromonas sp. CNPT3
Start position: 2159336
End position: 2159359
Length: 24

DNA sequence
>NC_020802, from 2159336 to 2159359 (24 bp); Psychromonas sp. CNPT3 TTTCAATTTCAGCTTCAATTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2158405-2159736	Sequence	PCNPT3_09130 - phosphoglucosamine mutase (Protein is coded in complementary strand; from 2159736 to 2158405)