Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 592103
End position: 592210
Length: 108

DNA sequence
>NC_020568, from 592103 to 592210 (108 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 CAGATAGCGACTCAGATTCAGACAGTGACTCAGACTCAGATAGCGACTCAGACTCAGACAGTGACTCAGA CTCAGACAGCGATTCAGATTCAGATAGCGACTCAGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 591852-592340	Sequence	SAI8T7_1004330 - hypothetical protein (Protein is coded in complementary strand; from 592340 to 591852)