Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 587954
End position: 588007
Length: 54

DNA sequence
>NC_020568, from 587954 to 588007 (54 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 TCAGATAGTGATTCAGATTCAGATAGTGATTCAGATTCAGATAGTGATTCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 584532-588689	Sequence	SAI8T7_1004310 sdrD Serine-aspartate repeat-containing protein D