Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 583553
End position: 583660
Length: 108

DNA sequence
>NC_020568, from 583553 to 583660 (108 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 GACTCAGACAGCGACTCAGACTCAGATAGTGATTCAGATTCGGACAGCGACTCAGATTCAGACAGCGAAT CAGATTCGGATAGCGACTCAGACTCAGATAGCGACTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 581304-584165	Sequence	SAI8T7_1004300 sdrC Serine-aspartate repeat-containing protein C