Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 2688262
End position: 2688297
Length: 36

DNA sequence
>NC_020568, from 2688262 to 2688297 (36 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 GGATCTTTCGATGCATCTTTCAATGCATCTTTCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2686969-2688882	Sequence	SAI8T7_1019810 - Putative Cell-wall-anchored protein SasF (Protein is coded in complementary strand; from 2688882 to 2686969)