Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 2615378
End position: 2615407
Length: 30

DNA sequence
>NC_020568, from 2615378 to 2615407 (30 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 ACTTACTTTTAATTACTTTCACTTTCTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2615194-2615784	Sequence	SAI8T7_1019300 - hypothetical protein (Protein is coded in complementary strand; from 2615784 to 2615194)