Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 2498637
End position: 2498663
Length: 27

DNA sequence
>NC_020568, from 2498637 to 2498663 (27 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 ATCTTTATAATCTTTAAAATCTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2498362-2499159	Sequence	SAI8T7_1018470 - Putative lipoprotein (Protein is coded in complementary strand; from 2499159 to 2498362)