Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 2307247
End position: 2307282
Length: 36

DNA sequence
>NC_020568, from 2307247 to 2307282 (36 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 AACTACAACGACTACAACAACTACGACAACTACATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2307120-2307620	Sequence	SAI8T7_1016980 - SA2097 protein