Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 2025908
End position: 2025931
Length: 24

DNA sequence
>NC_020568, from 2025908 to 2025931 (24 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 TTTGGATTCGGATTTGGCTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2025197-2026405	Sequence	SAI8T7_1014900 - Putative SdrH protein (Protein is coded in complementary strand; from 2026405 to 2025197)