Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 1852572
End position: 1852595
Length: 24

DNA sequence
>NC_020568, from 1852572 to 1852595 (24 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 AATAATAATAGTAATCATAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1852351-1852845	Sequence	SAI8T7_1013370 - hypothetical protein