Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 1695418
End position: 1695442
Length: 25

DNA sequence
>NC_020568, from 1695418 to 1695442 (25 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 TTCTTTTTTTATCTTTTCTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1694570-1695490	Sequence	SAI8T7_1012250 dnaI Primosomal protein (Protein is coded in complementary strand; from 1695490 to 1694570)