Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 1372348
End position: 1372392
Length: 45

DNA sequence
>NC_020568, from 1372348 to 1372392 (45 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1372347-1373330	Sequence	SAI8T7_1010040 pstS Phosphate-binding protein pstS (Protein is coded in complementary strand; from 1373330 to 1372347)