Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 1084704
End position: 1084730
Length: 27

DNA sequence
>NC_020568, from 1084704 to 1084730 (27 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1083077-1085014	Sequence	SAI8T7_1008020 isdB Iron-regulated surface determinant protein B (Protein is coded in complementary strand; from 1085014 to 1083077)