Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 1000170
End position: 1000223
Length: 54

DNA sequence
>NC_020568, from 1000170 to 1000223 (54 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 TTGTTAGGGTTATCAGGATTGTTAGGGTTATCAGGATTGTTAGGGTTATCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1000077-1001105	Sequence	SAI8T7_1007420 sspA Glutamyl endopeptidase (Protein is coded in complementary strand; from 1001105 to 1000077)