Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583
Start position: 212249
End position: 212284
Length: 36

DNA sequence
>NC_020568, from 212249 to 212284 (36 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 18583 TAATCATTTTAACCATCATTTTAATTATCATTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 212105-213268	Sequence	SAI8T7_1001540 - hypothetical protein