Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 98760
End position: 98831
Length: 72

DNA sequence
>NC_020566, from 98760 to 98831 (72 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 CGTTGCCGTCTTCTTTACCAGGTTTGTTGCCGTCTTCTTTACCAGGCTTGTTGCCGTCTTCTTTACCAGG CT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 98471-99883	Sequence	SAI5S5_1000670 - Gram-positive signal peptide protein, YSIRK family (Protein is coded in complementary strand; from 99883 to 98471)