Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 591906
End position: 591959
Length: 54

DNA sequence
>NC_020566, from 591906 to 591959 (54 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 GATTCAGACAGCGACTCAGACGCAGACAGCGATTCAGACGCAGACAGCGACTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 589015-592440	Sequence	SAI5S5_1004300 sdrE Serine-aspartate repeat-containing protein E