Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 587886
End position: 587939
Length: 54

DNA sequence
>NC_020566, from 587886 to 587939 (54 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 TCAGATAGTGATTCAGATTCAGATAGTGATTCAGATTCAGATAGTGATTCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 584464-588621	Sequence	SAI5S5_1004290 sdrD Serine-aspartate repeat-containing protein D