Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 428450
End position: 428473
Length: 24

DNA sequence
>NC_020566, from 428450 to 428473 (24 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 427789-428988	Sequence	SAI5S5_1003120 - Type I restriction modification DNA specificity domain protein