Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 2663623
End position: 2663712
Length: 90

DNA sequence
>NC_020566, from 2663623 to 2663712 (90 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 GAATCGCTATCTGATTCTGAATCGCTATCTGAATCTGAATCGCTATCTGAATCTGAGTCGCTATCTGATT CTGAATCGCTATCTGATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2662945-2665578	Sequence	SAI5S5_1019610 clfB Clumping factor B (Protein is coded in complementary strand; from 2665578 to 2662945)