Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 2615507
End position: 2615536
Length: 30

DNA sequence
>NC_020566, from 2615507 to 2615536 (30 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 ACTTACTTTTAATTACTTTCACTTTCTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2615323-2615913	Sequence	SAI5S5_1019260 - hypothetical protein (Protein is coded in complementary strand; from 2615913 to 2615323)