Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 2498770
End position: 2498796
Length: 27

DNA sequence
>NC_020566, from 2498770 to 2498796 (27 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 ATCTTTATAATCTTTAAAATCTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2498495-2499292	Sequence	SAI5S5_1018430 - Putative lipoprotein (Protein is coded in complementary strand; from 2499292 to 2498495)