Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 212365
End position: 212400
Length: 36

DNA sequence
>NC_020566, from 212365 to 212400 (36 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 TAATCATTTTAACCATCATTTTAATTATCATTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 212221-213384	Sequence	SAI5S5_1001530 - hypothetical protein