Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 2026045
End position: 2026068
Length: 24

DNA sequence
>NC_020566, from 2026045 to 2026068 (24 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 TTTGGATTCGGATTTGGCTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2025334-2026542	Sequence	SAI5S5_1014860 - Putative SdrH protein (Protein is coded in complementary strand; from 2026542 to 2025334)