Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 1695554
End position: 1695578
Length: 25

DNA sequence
>NC_020566, from 1695554 to 1695578 (25 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 TTCTTTTTTTATCTTTTCTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1694706-1695626	Sequence	SAI5S5_1012210 dnaI Primosomal protein (Protein is coded in complementary strand; from 1695626 to 1694706)