Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 1372484
End position: 1372528
Length: 45

DNA sequence
>NC_020566, from 1372484 to 1372528 (45 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1372483-1373466	Sequence	SAI5S5_1010000 pstS Phosphate-binding protein pstS (Protein is coded in complementary strand; from 1373466 to 1372483)