Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125
Start position: 1324682
End position: 1324705
Length: 24

DNA sequence
>NC_020566, from 1324682 to 1324705 (24 bp); Staphylococcus aureus subsp. aureus ST228 complete genome, isolate 16125 CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1324580-1325068	Sequence	SAI5S5_1009640 - Putative uncharacterized protein MW1234